What is the translation of " ALLELE " in English?

• ALLELE

Examples of using ALLELE in Swedish and their translations into English

Huruvida ALLELE.NO. SNP-filen är skadad.
Whether the ALLELE.NO. SNP file is damaged.

Kan jag ändra utvidgningen av ALLELE.NO. SNP-filer?
Can I change the extension of ALLELE.NO. SNP files?

Allele: En variant av en gen en viss sekvens.
Allele: A variant of a gene a particular sequence.

Vilka program behöver jag öppna en ALLELE.NO. SNP-fil?
What programs do I need to open a ALLELE.NO. SNP file?

G-varianten av denna allele var acne-producera bildar.
The G-variant of this allele was the acne-producing form.

Vad kan orsaka problem bredd öppna en ALLELE.NO. SNP-fil?
What else may cause problems width open a ALLELE.NO. SNP file?

Hur konverterar man ALLELE.NO. SNP-filer till ett annat filformat?
How to convert ALLELE.NO. SNP files to another file format?

Hur konverterar man en annan fil till ALLELE.NO. SNP filformat?
How to convert another files to ALLELE.NO. SNP file format?

Huruvida ALLELE.NO. SNP-filen är felaktigt länkad i registret.
Whether the ALLELE.NO. SNP file is incorrectly linked in the registry entries.

Anledningarna till bristen på möjligheten att öppna en ALLELE. NO.
The reasons for the lack of the ability to open a ALLELE. NO.

Detta preferens- uttryck av en allele är viktigt för det normalautveckling.
This preferential expression of one allele is important for normal development.

Vilka program hjälper till att skapa och redigera en ALLELE.NO. SNP-fil?
What programs help to create and edit a ALLELE.NO. SNP file?

Om ALLELE.NO. SNP-filtillägget av misstag har tagits bort från Windows-registret.
Whether the ALLELE.NO. SNP file extension has been accidentally removed from the Windows registry.

Var kan jag ladda ner programmet som stöder ALLELE.NO. SNP-fil?
Where I can download the application that support ALLELE.NO. SNP file?

Andra jämförelser har använt överförda familial alleles med non-överförda alleles för att identifiera riskera som framläggas av varje allele.
Other comparisons have used transmitted familial alleles with non-transmitted alleles to identify the risk presented by each allele.

Om installationen av en applikation som stöder filformatet ALLELE.NO.
Whether the installation of an application that supports the ALLELE. NO.

I kvinnlig, som har två x-kromosomer, om en allele muteras, visar det inte
In females who have two X chromosomes, if one allele is mutated,

redigerar eller konverterar ALLELE.NO. SNP-filer.
edit or convert ALLELE.NO. SNP files.

Folket med ärftlig cancer ställer ut redan en mutation i en allele som den menande endast en mutationen i den annan allelen krävs för förhindrandet av proteinbildande. Folket utan den ärftliga mutationen av en allele kräver därför'-två-hits'.
People with hereditary cancer already exhibit a mutation in one allele meaning only one mutation in the other allele is required for the prevention of protein formation.

en lista över program som stöder ALLELE. NO.
a list of programs that support ALLELE. NO.

Det finns osäkerhet som angår genfällaprocentsatsen, som producerar en riktig ogiltig allele, och defälla mutationarna täcker ultimately genom del.
There exists uncertainty concerning the gene trap percentage, which produces a true null allele and the gene-trap mutations ultimately cover the genome fraction.

för riskera av ADHD med varje allele.
for the risk of ADHD with each allele.

Om installationen av en applikation som stöder filformatet ALLELE.NO. SNP är ofullständigt.
Whether the installation of an application that supports the ALLELE.NO. SNP file format is incompletely.

På den andra sidan av denna sida hittar du detaljerad information om alla ALLELE. NO.
In the further part of this page, you will find detail information about all the ALLELE. NO.

AflIII äcklig om PCR produkt; den börd allele slog inte sammandrag Den M20 märkaren(lömsk et al. 1997) var anleggspreg,
AGCTGACCACAAACTGATGTAGA followed by AflIII digestion of the PCR product; the ancestral allele was not digested. The M20 marker(Underhill et al. 1997)

som öppnar en ALLELE.NO. SNP-fil.
which will open a ALLELE.NO. SNP file.

Huruvida drivrutinerna för utrustningen som används för att öppna en ALLELE.NO. SNP-fil är aktuella.
Whether the drivers of the equipment used for opening a ALLELE.NO. SNP file are up to date.