What is the translation of " POLYPEPTID " in English?

Noun
polypeptide
polypeptid
transportpolypeptid

Examples of using Polypeptid in Swedish and their translations into English

{-}
  • Medicine category close
  • Colloquial category close
  • Official category close
  • Ecclesiastic category close
  • Ecclesiastic category close
  • Official/political category close
  • Computer category close
  • Programming category close
  • Political category close
Phe kan också inkorporeras in i polypeptiden kedjar.
Phe can also be incorporated into polypeptide chains.
Det finns fyra som polypeptiden kedjar rymt tillsammans av disulfideförbindelser.
There are four polypeptide chains held together by disulfide bonds.
Hämmare av organisk, anjontransporterad polypeptid OATP-hämmare.
Organic anion transporting polypeptide(OATP) inhibitors.
Dessa fyra som polypeptiden kedjar, bildar ett symmetriskt molekylärt strukturerar.
These four polypeptide chains form a symmetrical molecular structure.
De amino syrorna bildar först ett långt kedjar kallat polypeptiden kedjar.
The amino acids first form a long chain called the polypeptide chain.
Combinations with other parts of speech
Usage with verbs
Den tillväxthormoner är en polypeptid hormon som bestar av 191 aminosyror.
The growth hormones is a polypeptide hormone consisting of 191 amino acids.
Först bildar de amino syrorna ett långt kedjar kallat polypeptiden kedjar.
First, the amino acids form a long chain called the polypeptide chain.
STOPPcodons signalerar avsluta av polypeptiden kedjar under proteinsyntes.
STOP codons signal the end of the polypeptide chain during protein synthesis.
Polypeptiden består av 65 aminosyror och har en molekylvikt på 6979, 5 Dalton.
The polypeptide composed of 65 amino acids has a molecular weight of 6979.5 Dalton.
Dessa codons signalerar avsluta av polypeptiden kedjar under översättning.
These codons signal the end of the polypeptide chain during translation.
Eftersom polypeptid hormoner inte är fettlösliga,
Because polypeptide hormones are not fat-soluble,
Må bra-hormonet är ett litet protein, en polypeptid som består av 9 aminosyror.
The feel-good hormone is a small protein, a polypeptide consisting of 9 amino acids.
Tre som polypeptiden kedjar, lindar tillsammans för att bilda ett styvt spiralformigt strukturerar.
Three polypeptide chains wind together to form a stiff helical structure.
är en polypeptid hormon som produceras av placenta hos människa.
is a polypeptide hormone produced by the human placenta.
Polypeptiden Syn-Ake avslappnar omedelbart musklerna på ett smärtfri
Polypeptide Syn-Ake instantly loosens the smooth muscles,
Också i surolana har polymyxin B- en polypeptid antibiotikum som är aktivt mot gramnegativa bakterier;
Also in the composition of surrolan is polymyxin B- a polypeptide antibiotic that acts against gram-negative bacteria;
denaturerade proteiner av längden på polypeptid.
denatured proteins by the length of the polypeptide.
Vikning av polypeptiden skapar ett aktivprotein som är kompetent att utföra, fungerar inom cellen.
Folding of the polypeptide creates an active protein, able to perform functions within the cell.
är en polypeptid hormon som stimulerar tillväxt
is a polypeptide hormone which stimulates growth
glukosberoende insulinotropisk polypeptid GIP.
glucose-dependent insulinotropic polypeptide GIP.
Den har fyra som polypeptiden kedjar- kedjar identisk"skurkroll två", och identiska två"tänder kedjar.
It has four polypeptide chains- two identical''heavy chains'' and two identical''light chains.
Hemoglobin är ett klotformigt protein som bestås av av fyra som polypeptiden kedjar med enband grupp som kallas heme på varje, kedjar.
Hemoglobin is a globular protein comprised of four polypeptide chains with an iron-binding group called heme on each chain.
natriumtaurokolat cotransporterande polypeptid(NTCP) eller OATPs.
sodium-taurocholate cotransporting polypeptide(NTCP), or OATPs.
Det är en enkelkedjig polypeptid bestående av 191 aminosyror och är en av fem grundläggande hypofyshormoner.
It is a single chain polypeptide comprised of 191 amino acids and is one of five basic pituitary hormones.
I översättning avkodas budbärar-RNA(mRNA) producerad av transkription av Ribosomen att producera en specifik amino syra kedjar, eller polypeptid, som senare kommer att vika till en aktiv protein.
In translation, messenger RNA(mRNA) produced by transcription is decoded by the ribosome to produce a specific amino acid chain, or polypeptide, that will later fold into an active protein.
Denna 76 aminosyror långa polypeptid isolerades från kalvbräss och antogs delta vid bildandet av vita blodkroppar.
This 76-amino-acid-long polypeptide was isolated from calf sweetbread and was assumed to participate in the maturation of white blood cells.
glukosberoende insulinotropisk polypeptid GIP.
glucose-dependent insulinotropic polypeptide GIP.
Bevarad sekvens: En aminosyrasekvens i en polypeptid eller en nukleotidsekvens i DNA
Conserved Sequence: A sequence of amino acids in a polypeptide or of nucleotides in DNA
glukosberoende insulinotropisk polypeptid.
glucose- dependent insulinotropic polypeptide.
Hämmare av organisk, anjontransporterad polypeptid(OATP-hämmare): Prekliniska studier indikerar
Organic anion transporting polypeptide(OATP) inhibitors: Preclinical studies indicate
Results: 34, Time: 0.0282

How to use "polypeptid" in a Swedish sentence

Kemi NPU03021 Pankreas Polypeptid ,72 Klin.
Kallas även vasoaktiv intestinal polypeptid eller vipom.
Pankreas polypeptid produceras också I Langerhanska öarna.
En syntetisk polypeptid med adrenokortikotrop verkan.Aldosteron: (11-beta)-11,21-dihydroxy-3,20-dioxopregn-4-en-18-al.
Et polypeptid hvis funktion bl.a, alerlisin malmö sweden.
Et polypeptid hvis funktion bl.a, bästa avedox fc.
Et polypeptid hvis funktion bl.a, excef göteborg billigt.
En polypeptid som stimulerar tillväxten av epidermala celler.
Pankreatisk polypeptid Ett hormon som produceras i bukspottkörteln.
Et polypeptid hvis funktion bl.a, beställa sorfox stockholm.

How to use "polypeptide" in an English sentence

The TAT polypeptide sequence alone was ineffective.
Production of recombinant polypeptide toxins (Andreev Ya.A.
Polypeptide chain and are thus called monomeric.
What is the function of growing polypeptide chain?
The spatial arrangement of the polypeptide chain.
Collection of polypeptide concatenation signifier quaternate constructions.
Polypeptide chains are parallel to each other.
Neural induction by the secreted polypeptide noggin.
Glucose-dependent insulinotropic polypeptide (GIP): anti-diabetic and anti-obesity potential?
TGTTGTGATCCATATTTCGCCTTCACCACCGAAATTTTAGTGAACCGAAGATTTCAGGTCACTGTCCATTC mRNA 5 cap CACUUGGCUUCUAAAGUCCAGUGACAG Polypeptide GTTCTCGTTACTTCCGTCTCGATTACTAAGATTTGATTACTTTTAGAAAAATGACCGAAGATCCAAAGCAGATTGCCCAGGAGACTGAG.
Show more

Top dictionary queries

Swedish - English