Wat Betekent OLIGONUCLEOTIDES in het Nederlands - Nederlands Vertaling

Voorbeelden van het gebruik van Oligonucleotides in het Engels en hun vertalingen in het Nederlands

{-}
  • Colloquial category close
  • Official category close
  • Ecclesiastic category close
  • Medicine category close
  • Financial category close
  • Computer category close
  • Ecclesiastic category close
  • Official/political category close
  • Programming category close
Rapid and efficient purification of DNA and Oligonucleotides.
Snelle en efficiënte zuivering van DNA en Oligon.
Oligonucleotides are small pieces of DNA
Oligonucleotiden zijn kleine stukjes DNA
Suitable for transfection miRNA and other oligonucleotides.
Geschikt voor transfectie van miRNA en andere oligonucleotiden.
Some techniques, like antisense oligonucleotides have been around for decades.
Sommige technieken, zoals antisense oligonucleotiden zijn al decennia beschikbaar.
Step 9: Ditags are cleaved to remove the oligonucleotides.
Stap 9: Ditags wordt gespleten om oligonucleotides te verwijderen.
For example, therapeutic oligonucleotides are highly unstable hydrophilic molecules that are negatively charged.
Bijvoorbeeld, therapeutische zijn oligonucleotides hoogst onstabiele hydrofiele molecules die negatief- geladen zijn.
Synthesis and structure determination of phosphonate oligonucleotides.
Synthese en structuurbepaling van fosfonaat oligonucleotiden.
A mixed pool of fluorescently labeled oligonucleotides is added to the reaction mixture.
Een gemengde pool van fluorescently geëtiketteerde oligonucleotides wordt toegevoegd aan het reactiemengsel.
proteins, oligonucleotides.
proteà ̄nen, oligonucleotides.
Oligonucleotides are built using protected phosphoramidites of natural
Oligonucleotides zijn het gebouwde gebruiken beschermd phosphoramidites van natuurlijke
proteins and oligonucleotides.
eiwitten en oligonucleotiden.
Oligonucleotides are short nucleic acid polymers used in research,
Oligonucleotides zijn korte nucleic zuurpolymeren die in onderzoek, het genetische testen
Furthermore, they were also used coupled with oligonucleotides for in situ hybridization.
Voorts werden zij ook gebruikt gekoppeld aan oligonucleotides voor kruising in situ.
They can also analyze and resolve complex assortments of smaller peptides and oligonucleotides.
Zij kunnen complexe assortimenten van kleinere peptides en oligonucleotides ook analyseren en oplossen.
Step 5: Two oligonucleotides with sticky ends are added to the remaining truncated cDNA,
Stap 5: Twee oligonucleotides met kleverige einden worden toegevoegd aan blijven beknot cDNA,
while DOP-PCR uses semi-degenerate oligonucleotides.
het gebruik dop-PCR oligonucleotides semi-degenereert.
Oligonucleotides made up of 2'-deoxyribonucleotides are the molecules used in polymerase chain reaction PCR.
Oligonucleotides die uit 2' wordt samengesteld- deoxyribonucleotides zijn de molecules die in polymerasekettingreactie worden gebruikt PCR.
Another approach uses a slightly different molecule called anti-sense oligonucleotides, or ASOs.
Een andere benadering maakt gebruik van een iets ander molekule, anti-sense oligonucleotides, of ASO's genoemd.
Synthetic oligonucleotides called aptamers,
Aptameren, synthetische oligonucleotiden die interageren met specifieke moleculen,
Using the molecules as probes for detection is one of the most important functions of oligonucleotides.
Het gebruiken van de molecules als sondes voor opsporing is één van de belangrijkste functies van oligonucleotides.
For Drop-seq, the beads(which are attached to the oligonucleotides and mRNAs) are released from the drops
Voor daling-Seq, worden de parels(die aan oligonucleotides en mRNAs) in bijlage zijn vrijgegeven van de dalingen
proteins, and oligonucleotides.
proteïnen, en oligonucleotides verbonden.
Oligonucleotides are usually made up of 13 to 25 nucleotides
Oligonucleotides worden gewoonlijk samengesteld uit 13 tot 25 nucleotiden en om specifiek aan
Each of the RNA enzymes synthesizes the other from synthetic oligonucleotides, in the absence of any protein.
Elk van de enzymen van RNA stelt andere van synthetische oligonucleotides, bij gebrek aan om het even welke proteà ̄ne samen.
Kary Mullis of Cetus worked on oligonucleotides synthesis for use as probes,
Kary Mullis van Cetus werkte bij oligonucleotides de synthese voor gebruik
Development of a universal potentiometric biosensing platform using oligonucleotides as recognition elements.
Ontwikkeling van een universeel potentiometrisch biosensor platform gebruik makend van oligonucleotiden als herkenningselementen.
Oligonucleotides are short DNA or RNA molecules, oligomers, that have a wide range of applications in genetic testing, research, and forensics.
Een oligonucleotide is een relatief kort enkelstrengs-DNA of-RNA dat een ruim toepassingsgebied heeft in genetische screening,recombinant-DNA- en forensisch onderzoek.
The microdrops are surrounded by oil and contain a bead with a uniquelt barcoded set of oligonucleotides as well as a single cell.
Microdrops worden omringd door olie en bevatten een parel met een uniqueltreeks met streepjescode van oligonucleotides evenals single cell.
Oligonucleotides are short chains of base pairs that are used for a variety of applications in research,
Oligonucleotides zijn korte kettingen van basisparen die voor een verscheidenheid van toepassingen in onderzoek, het genetische testen
For InDrop, the beads dissolve in the microdrops which releases the oligonucleotides to hybridize with the mRNAs,
Voor InDrop, lossen de parels in microdrops op wat oligonucleotides vrijgeeft met mRNAs te kruisen,
Uitslagen: 50, Tijd: 0.0368

Hoe "oligonucleotides" te gebruiken in een Engels zin

Impure cDNAs or oligonucleotides used for spotting.
Sequence of the oligonucleotides used for 3C.
Sequence of the oligonucleotides used for qPCR.
The double-stranded oligonucleotides were end-labeled with [γ-32P]-ATP.
Therapeutic Antisense Oligonucleotides Are Coming of Age.
Oligonucleotides were purchased from Microsynth (Balgach, CH).
The 2 oligonucleotides were 5′(AGCTTATCGCGGCCGCTAGATAGATAG) and 5′(GCGGCCCTATCTATCTAGCGGCCGCGATA).
QRT-PCR oligonucleotides for oatps, actin, kat, B.
The potential of oligonucleotides for therapeutic applications.
All oligonucleotides were synthesized by Genepharma Co.
Laat meer zien

Hoe "oligonucleotides" te gebruiken in een Nederlands zin

Gold, L. (1995), Oligonucleotides as research diagnostics, and therapeutic agents, 1.
Subsequently, the bound oligonucleotides can be released from the target and amplified by means of Polymerase Chain Reaction (PCR).
Toulmd, J-J. (2000), Aptamers: Selected oligonucleotides for therapy, Curr.
In vitro synthesis of oligonucleotides or antisense RNAs which are complementary to a specific mRNA, and which are then introduced into the cell. 5 2.
Synthetic biomolecules such as oligonucleotides may also be used as analytes.
Lemmer, “Probing Activated Sludge with Oligonucleotides Specific for Proteobacteria : Inadequacy of Culture-Dependent Methods for Describing Microbial Community Structure.,” Appl.
For this purpose, can be brought in vitro synthesized antisense RNA or synthetic complementary oligonucleotides in the cell 20.
Inhibition of the gene expression by means of synthetic oligonucleotides has three advantages.
Het PlatON™, proprietary chemistry platform of decoy agonist oligonucleotides kan op termijn haar beloften waarmaken (AsiDNA™ en OX401).
To this end, synthetic oligonucleotides or in vitro synthesized antisense RNA can be introduced into the cells.

Top woordenboek queries

Engels - Nederlands