Exemplos de uso de Target sequence em Inglês e suas traduções para o Português
{-}
-
Colloquial
-
Official
-
Medicine
-
Financial
-
Ecclesiastic
-
Ecclesiastic
-
Computer
-
Official/political
Target… target sequence confirmed!
The memorial will be over long before we can ID the target sequence.
For the nested PCRs, IS6110 of M. tuberculosis was used as the target sequence GenBank accession no.
When the probe connects to the target sequence, the device produces an electrochemical signal that is recorded and processed by software.
When the pairing of nitrogenized bases occurs due to the annealing of the target sequence with the region of the guide RNA protospacer.
The target sequence was a 110pb segment and we used the following primers from 5' to 3': PCO3: ACACAACTGTGTTCACTAGC; PCO4: CAACTTCATCCACGTTCACC.
The guide RNA is designed to recognize the target sequence to be modified in the RNA and.
As the Cpf1 cuts far awayfrom the target gene, editing can be performed several times in order to ensure correct cutting of the target sequence.
The sample to be amplified, or target sequence, of a specific gene or gene portion, consists of a known base sequence. .
Under optimal conditions(i.e., if there are no limitations due to limiting substrates or reagents), at each extension/elongation step,the number of DNA target sequences is doubled.
In the reinforcement phase, an easy target sequence(s1) was reinforced for half of the participants, and a difficulty sequence, for the other half.
The main purpose of AmplifX is to seek in a collection of primers, such as any molecular biologist get in his refrigerators,those which can be use to amplify a fragment into a target sequence, for example, and particularly, to design strategies to screen….
For accurate quantification of the target sequences specific primers based on the gene sequence of the minicircle and albumin(reference gene) were used.
This example comes fromone of the studies used in the analysis, butother studies either used different target sequences(e.g. looking for the sequence 2, 4, 6) or other tests of the same basic skill.
After immobilisation, the hybridisation with target sequence is detected by changes in surface properties of ito electrode by cyclic voltammetry and electrochemical impedance spectroscopy, using the ferri-ferrocyante redox couple. the detectio.
In CRISPR system, the aforementioned Cas9 protein is directed towards thetarget site using gRNA, which consists of a 20-base pair protospacer that attaches to the complementary strand of the target sequence, as well as a constant region interacting with the Cas9 protein.
Target sequences of the viral DNA were inserted into synthetic plasmid, which served as a positive control for the standardization of techniques and optimization of reagents, determination of limits of detection and performance verification testing.
Developed from molecular organisms of the bacterial immune system, the CRISPR system allows the edition of the genome by means of splicing of the DNA by an endonuclease Cas9, guided based on an RNA sequence, which is able to pair up with the bases of a target sequence Figure 1.
Target sequences for amplification of DNA from M. leprae, such as genes encoding proteins of 65, 36 and 18kDa, and repetitive sequences, have been widely used for the etiological diagnosis of leprosy, and have often proved to be more sensitive and specific than the routinely-used bacilloscopic examination.
In their experiment, the group immobilized an excerpt of the region of DNA where this mutation occurs on the surface of the device. When the corresponding sequence is placed on the electrode, the connection triggers a change in the equipment's electrical response,indicating the presence of the target sequence which is linked to the mutation.
Targeting sequence on.
Target sequencing locked.
The targeting sequence is similar to that used for mitochondria and true mitochondrial presequences will deliver proteins to mitosomes.
Like mitochondria, they have a double membrane andmost proteins are delivered to them by a targeting sequence of amino acids.
When the targeting sequence ends, Marston automatically fires to all marked locations in extremely quick succession.
These transfers caused most of the organellar proteins to be coded by the nucleus, then synthesized in the cytosol andtargeted to the organelles by a complex machinery which involves membrane receptors in the organelles, targeting sequences in the proteins, and cytosolic proteins which assist them with the transport.
Starting the targeting sequence.
The target DNA sequence is inserted into a cloning vector.
Add to this the targeting sequences ISBT visceraise dysfunction as a result we have a comprehensive approach to health problems.