O Que é TARGET SEQUENCE em Português

['tɑːgit 'siːkwəns]
Substantivo
['tɑːgit 'siːkwəns]
sequência-alvo
target sequence
sequência alvo
target sequence
a sequência alvo

Exemplos de uso de Target sequence em Inglês e suas traduções para o Português

{-}
  • Colloquial category close
  • Official category close
  • Medicine category close
  • Financial category close
  • Ecclesiastic category close
  • Ecclesiastic category close
  • Computer category close
  • Official/political category close
Target… target sequence confirmed!
Alvo… sequência alvo confirmada!
The memorial will be over long before we can ID the target sequence.
A missa irá acabar antes de conseguir identificar o alvo.
Time on target sequence: complete.
Sequência sobre o alvo: completa.
For the nested PCRs, IS6110 of M. tuberculosis was used as the target sequence GenBank accession no.
Para as nested PCRs, utilizou-se IS6110 do M. tuberculosis como sequência alvo GenBank nº de acesso NP 215310.1.
When the probe connects to the target sequence, the device produces an electrochemical signal that is recorded and processed by software.
Ao se ligar à sequência-alvo, o aparelho produz um sinal eletroquímico que é registrado e processado por um software.
When the pairing of nitrogenized bases occurs due to the annealing of the target sequence with the region of the guide RNA protospacer.
Quando o pareamento de bases nitrogenadas ocorre em função do anelamento da sequência-alvo com a região do protoespaçador do RNA.
The target sequence was a 110pb segment and we used the following primers from 5' to 3': PCO3: ACACAACTGTGTTCACTAGC; PCO4: CAACTTCATCCACGTTCACC.
A sequência alvo é um segmento de 110pb e foram utilizados os seguintes primers de 5' para 3': PCO3: ACACAACTGTGTTCACTAGC; PCO4: CAACTTCATCCACGTTCACC.
The guide RNA is designed to recognize the target sequence to be modified in the RNA and.
O RNA guia é projetado para reconhecer a sequência-alvo a ser modificada no DNA e.
As the Cpf1 cuts far awayfrom the target gene, editing can be performed several times in order to ensure correct cutting of the target sequence.
Enquanto o Cpf1 corta longe do gene do alvo,editar pode ser executada diversas vezes a fim assegurar a estaca correcta da seqÃ1⁄4Ãancia do alvo.
The sample to be amplified, or target sequence, of a specific gene or gene portion, consists of a known base sequence..
A amostra a ser amplificada, ou seja, a seqüência alvo de um determinado gene ou parte dele, constitui uma seqüência de bases previamente conhecida.
Under optimal conditions(i.e., if there are no limitations due to limiting substrates or reagents), at each extension/elongation step,the number of DNA target sequences is doubled.
Em condições ideais(isto é, se não houver limitações devido a substratos ou reagentes limitantes), em cada etapa de extensão/ alongamento,o número de sequências alvo de DNA é duplicado.
In the reinforcement phase, an easy target sequence(s1) was reinforced for half of the participants, and a difficulty sequence, for the other half.
Na fase de reforçamento, uma sequência alvo(s1) fácil foi reforçada para metade dos participantes e uma sequência difícil, para a outra metade.
The main purpose of AmplifX is to seek in a collection of primers, such as any molecular biologist get in his refrigerators,those which can be use to amplify a fragment into a target sequence, for example, and particularly, to design strategies to screen….
O principal objetivo do AmplifX é buscar em uma coleção de primers, como qualquer biólogo molecular entrar em suas geladeiras,aqueles que podem ser usado para amplificar um fragmento em uma sequência alvo, por exemplo, e, particularmente, para projetar….
For accurate quantification of the target sequences specific primers based on the gene sequence of the minicircle and albumin(reference gene) were used.
Para a quantificação exata das sequências alvo foram usados primers específicos baseados na sequência do gene do kdna e albumina gene de referência.
This example comes fromone of the studies used in the analysis, butother studies either used different target sequences(e.g. looking for the sequence 2, 4, 6) or other tests of the same basic skill.
Este exemplo vem de um dosestudos utilizados na análise, mas outros estudos também usou seqüências alvo diferentes(por exemplo, olhando para a seqüência 2, 4, 6) ou outros testes da mesma habilidade básica.
After immobilisation, the hybridisation with target sequence is detected by changes in surface properties of ito electrode by cyclic voltammetry and electrochemical impedance spectroscopy, using the ferri-ferrocyante redox couple. the detectio.
Após a imobilização, a hibridização com a sequência alvo é detectada através de alte-rações nas propriedades de superfície do el.
In CRISPR system, the aforementioned Cas9 protein is directed towards thetarget site using gRNA, which consists of a 20-base pair protospacer that attaches to the complementary strand of the target sequence, as well as a constant region interacting with the Cas9 protein.
No sistema de CRISPR, a proteína Cas9 acima mencionada é dirigida parao local do alvo usando o gRNA, que consiste em um protospacer baixo de 20 pares que anexe à costa complementar da seqÃ1⁄4Ãancia do alvo, assim como uma região constante que interage com a proteína Cas9.
Target sequences of the viral DNA were inserted into synthetic plasmid, which served as a positive control for the standardization of techniques and optimization of reagents, determination of limits of detection and performance verification testing.
Sequências-alvo do DNA viral foram inseridos em plasmídeo sintético, os quais serviram de controle positivo para a padronização das técnicas e otimização de reagentes, determinação dos limites de detecção e testes de verificação de desempenho.
Developed from molecular organisms of the bacterial immune system, the CRISPR system allows the edition of the genome by means of splicing of the DNA by an endonuclease Cas9, guided based on an RNA sequence,which is able to pair up with the bases of a target sequence Figure 1.
Desenvolvido a partir de mecanismos moleculares do sistema imunológico bacteriano, o sistema CRISPR possibilita a edição do genoma através de clivagem do DNA por uma endonuclease Cas9, guiada a partir de uma sequência de RNA,que é capaz de se parear com as bases de uma sequência-alvo Figura 1.
Target sequences for amplification of DNA from M. leprae, such as genes encoding proteins of 65, 36 and 18kDa, and repetitive sequences, have been widely used for the etiological diagnosis of leprosy, and have often proved to be more sensitive and specific than the routinely-used bacilloscopic examination.
Sequências alvos para a amplificação do DNA de M. leprae, como os genes que codificam as proteínas de 65, 36 e 18kDa, e sequências repetitivas têm sido as mais utilizadas para o diagnóstico etiológico da hanseníase e, muitas vezes, têm se mostrado mais sensíveis e específicas do que o exame baciloscópico rotineiramente utilizado.
In their experiment, the group immobilized an excerpt of the region of DNA where this mutation occurs on the surface of the device. When the corresponding sequence is placed on the electrode, the connection triggers a change in the equipment's electrical response,indicating the presence of the target sequence which is linked to the mutation.
No experimento que fizeram, eles imobilizaram na superfície do dispositivo um trecho da sequência complementar à região do DNA onde ocorre essa mutação, de modo que, quando a sequência correspondente fosse colocada no eletrodo, a ligação desencadeasse uma alteração na resposta elétrica do equipamento,indicando a presença da sequência-alvo ligada à mutação.
Targeting sequence on.
Sequência de alvo ligada.
Target sequencing locked.
Sequência de alvo fixada.
The targeting sequence is similar to that used for mitochondria and true mitochondrial presequences will deliver proteins to mitosomes.
A sequência alvo é semelhante às utilizadas por mitocôndrias e pré-sequências mitocondriais verdadeiras administrarão as proteínas para as mitossomas.
Like mitochondria, they have a double membrane andmost proteins are delivered to them by a targeting sequence of amino acids.
Como a mitocôndria, as mitossomas têm uma membrana dupla ea maioria das proteínas são entregues por um sequência alvo de aminoácidos.
When the targeting sequence ends, Marston automatically fires to all marked locations in extremely quick succession.
Quando a sequência de tiro acaba, Marston irá atirar em uma sucessão incrivelmente rápida nos alvos marcados.
These transfers caused most of the organellar proteins to be coded by the nucleus, then synthesized in the cytosol andtargeted to the organelles by a complex machinery which involves membrane receptors in the organelles, targeting sequences in the proteins, and cytosolic proteins which assist them with the transport.
Após a transferência gênica, a maioria das proteínas passaram a ser codificadas pelo núcleo, sintetizadas no citosol edirecionadas às organelas por uma maquinaria complexa que envolve receptores nas membranas das organelas, sequências de direcionamento nas proteínas e proteínas citossólicas que auxiliam o transporte.
Starting the targeting sequence.
A iniciar sequência de disparo.
The target DNA sequence is inserted into a cloning vector.
A sequência de DNA alvo é então inserida num vector de clonagem.
Add to this the targeting sequences ISBT visceraise dysfunction as a result we have a comprehensive approach to health problems.
Juntam-se a isto sequências ISBT específicas dirigidas a disfunções visceraise temos como resultado uma abordagem abrangente aos problemas de saúde.
Resultados: 243, Tempo: 0.0394

Tradução palavra por palavra

Principais consultas de dicionário

Inglês - Português