Examples of using Not digested in English and their translations into German
{-}
-
Colloquial
-
Official
-
Ecclesiastic
-
Medicine
-
Financial
-
Ecclesiastic
-
Political
-
Computer
-
Programming
-
Official/political
-
Political
That said you understand, but, this the"Father Prior," I have not digested.
Rice in large numbers partially is not digested in a stomach and"clogs" intestines.
If you want to regale on thin soup from haricot,watch that it was not digested.
Prebiotic fibers are not digested by humans and therefore have no direct nutritive value.
The people are already split in two and find themselves, unfortunately, today with a new enemy: Fatah,who has not digested its electoral defeat.
Green clay is not digested and excreted from the body together with the toxins naturally.
Because montomorillonite has such strong adsorptive properties and is not digested, it tightly binds material to be excreted. History of Use.
That lentil was not digested, it is better to put it not in cold water, and in the boiling.
Sanderson tried that which I[page] 126 used, as well as some freshly prepared, with artificial digestive liquid,and found that it was not digested.
Some amoebae keep algae as symbionts that are not digested but support the host by delivering photosynthesis products.
Try to use more than the liquid hot dishes which are not containing many excess food fibers,that is material which is not digested enzymes.
Some synthetic materials in the stomach of the caterpillar are not digested, but safely pass through in transit through the digestive tract.
Was typed, by use of the primers GTGGTTGCTGGTTGTTACGT and AGCTGACCACAAACTGATGTAGA followed by AflIII digestionof the PCR product; the ancestral allele was not digested.
Thanks to an ingenious mechanism they are not digested by the immune cells but remain locked inside the cells for a very long time.
In addition, the M17 marker(Underhill et al. 1997) was typed, by use of the primers GTGGTTGCTGGTTGTTACGT and AGCTGACCACAAACTGATGTAGA followed by AflIII digestion of the PCR product;the ancestral allele was not digested. The M20 marker(Underhill et al. 1997) was genotyped, by use of the primers CACACAACAAGGCACCATC and GATTGGGTGTCTTCAGTGCT followed by SspI digestion; the A?
You know, Patrick certainly still hasn't digested his experiences.
I can't digest my food.
My body can't digest beer and champagne in our evening meeting and tense talks.
Fibers are actually complex carbohydrates that humans cannot digest.
For a person who isn't digesting the daily vital amount of vitamins, nutrients, and proteins through their diet will ultimately suffer their organs ability to function properly.
Peter lightly sailed on a wave samozachwytu rally, not digest it became his comments about Rydzyny.
I at first concluded, as already stated,that the secretion could not digest this substance.
It“& ldquo; clings& rdquo; onto the fats,expanding them and also making it so the body just can not digest them.
These are now striking the market, but similar to anything you take inside, you will not digest it all.
These are now hitting the market, but as with anything you take internally, you will not digest it all.
Application/ Administration/ Information Lactose-OK promotes and stimulates the digestion of dairy products andavoid inconvenience due to difficulties digesting lactose not digest lactose.
These are now striking the marketplace, yet just like anything you take inside,you will not digest it all.
Without enough of it, muscles won't contract, blood won't circulate,food won't digest, and the heart won't beat.
These are now hitting the market, yet as with anything you take internally,you will certainly not digest it all.
These are now striking the market, but as with anything you take internally,you will not digest it all.