What is the translation of " POLYPEPTIDE " in Korean?

Noun
폴리펩티드
polypeptide
polypeptide
a polypeptide

Examples of using Polypeptide in English and their translations into Korean

{-}
  • Colloquial category close
  • Ecclesiastic category close
  • Ecclesiastic category close
  • Programming category close
  • Computer category close
Polypeptide Hormones(124).
폴리펩티드 호르몬 (124).
They form polypeptide chains.
합하여 polypeptide chain을 형성….
Polypeptide Epithalone/ Epithalon.
폴리펩티드 Epithalone Epithalon.
What's the difference between a polypeptide and a protein?
Polypeptides와 Protein의 차이는 무엇인가요?
Polypeptide Hormones HGH Fragment 176-191 Increases Muscle Mass.
폴리펩티드 호르몬 HGH 파편 176-191 증가 근육 질량.
People also translate
Relationship to vasoactive intestinal polypeptide.
VIP란 Vasoactive intestinal polypeptide라는 의미인데요.
Polypeptide Hormones PEG-MGF/ MGF For Weight Loss 2mg/ vials.
체중 감소 2mg/작은 유리병을 위한 폴리펩티드 호르몬 PEG-MGF/MGF.
Prepare polyclonal antibody with polypeptide antigen(10mg).
폴리펩티드 항원 (10mg)를 가진 polyclonal 항체를 준비하십시오.
Good Effect Polypeptide Hormone Powder Melanotan I 2mg/vial Half Life.
효력 폴리펩티드 호르몬 분말 Melanotan 좋은 I 2mg/vial 반감기.
The C-terminal carboxylate group of a polypeptide can also be modified, e.g..
폴리펩타이드의 C 말단은 다음과 같이 변형될 수 있다.
For example, a polypeptide may be conjugated to an immunoglobulin Fc region.
예를 들어, 폴리펩타이드는 면역글로불린 Fc 영역에 접합시킬 수 있다.
Lyophilized Inject 2mg/vial Hair Growth Steroid Sermorelin Polypeptide.
냉동 건조하는 2mg/vial 머리 성장 스테로이드 Sermorelin 폴리펩티드를 주사하십시오.
The N-terminal amino group of a polypeptide can be modified covalently, e.g..
폴리펩타이드의 N 말단은 다음과 같이 변형 될 수 있다.
The term“polypeptide” encompasses proteins of all functions, including enzymes.
폴리펩티드"란 용어는 효소를 포함하여 모든 기능의 단백질을 포함한다.
Cjc-1295 Hair Growth Powder Dac Polypeptide Lyophilized Inject 2mg/vial.
냉동 건조된 Cjc-1295 머리 성장 분말 Dac 폴리펩티드는 2mg/vial를 주사합니다.
Natural Polypeptide Hormones Bivalirudin Medicine Grade CAS 128270-60-0.
자연적인 폴리펩티드 호르몬 Bivalirudin 약 급료 CAS 128270-60-0.
Protein Peptide Hormones CJC-1295DAC Powder Polypeptide Materials Human Growth Hormone.
단백질 펩티드 호르몬 CJC-1295DAC 분말 폴리펩티드 물자 인간성장 호르몬.
Melanotan II Polypeptide Hormones Peptide Powder Melanotan-2 with 10mg.
Mg를 가진 Melanotan II 폴리펩티드 호르몬 펩티드 분말 Melanotan-2.
Large Image: Lyophilized Inject 2mg/vial Hair Growth Steroid Sermorelin Polypeptide.
큰 이미지: 냉동 건조하는 2mg/vial 머리 성장 스테로이드 Sermorelin 폴리펩티드를 주사하십시오.
Cosmetics Polypeptide Hormones Palmotoyl Oligopeptide, CAS 147732-56-7.
화장품 폴리펩티드 호르몬 Palmotoyl Oligopeptide, CAS 147732-56-7.
Somatrem is defined as a biosynthetic, single polypeptide chain that contains 192 amino acids.
Somatrem는 생 합성으로 정의, 포함 된 단일 polypeptide 사슬 192 아미노산.
Polypeptide Hormones Argpressin Acetate CAS 113-79-1 As Neurotransmitter.
신경전달물질로 98% 폴리펩티드 호르몬 Argpressin 아세테이트 CAS 113-79-1.
Potent Growth Muscle Building Polypeptide Hormones Ipamorelin 2mg/ vial 170851-70-4.
성장 근육 건물 폴리펩티드 호르몬 Ipamorelin 유력한 2mg/작은 유리병 170851-70-4.
Polypeptide Hormone Melanotan-II( MT2) Powder For Male Erectile Dysfunction Treatment.
남성 발기부전 처리를 위한 폴리펩티드 호르몬 Melanotan-II (MT2) 분말.
IGF1- LR3 Muscle Building Peptides Polypeptide Lyophilized Powder CAS 946870-92-4.
IGF1 - LR3 근육 건물 펩티드 폴리펩티드에 의하여 냉동 건조되는 분말 CAS 946870-92-4.
Polypeptide Desmopressin AcetateInjectable Anabolic Steroids CAS 16789-98-3.
폴리펩티드 Desmopressin AcetateInjectable 신진대사 스테로이드 CAS 16789-98-3.
Sermorelin Professional Muscle Growth Peptides Polypeptide Lyophilized Powder 2mg/Vial 86168-78-7.
Sermorelin 직업적인 근육 성장 펩티드 폴리펩티드는 분말 2mg/Vial 86168-78-7를 냉동 건조했습니다.
Injectable Polypeptide Hormones Ipamorelin CAS 170851-70-4 For Energy Homeostasis.
에너지 항상성을 위한 주사 가능한 폴리펩티드 호르몬 Ipamorelin CAS 170851-70-4.
IgM and IgE Fc regions contain three heavy chain constant domains(CH domains 2- 4) in each polypeptide chain.
IgM 및 IgE Fc 도메인은 각각의 폴리펩타이드 쇄에서 3 개의 중쇄 불변 도메인 (C H 도메인 2-4) 을 함유한다.
Muscle Building Polypeptide Hormones 9002-60-2 ACTH Adrendcorticotrophic Hormone.
근육 건물 폴리펩티드 호르몬 9002-60-2 ACTH Adrendcorticotrophic 호르몬.
Results: 218, Time: 0.0377

How to use "polypeptide" in an English sentence

The mature polypeptide contains 66 amino acids.
Atrial natriuretic polypeptide (ANP) in human ventricle.
Description: Cyclic polypeptide antibiotic from Bacillus colistinus.
A basic polypeptide isolated from Streptomyces netropsis.
P-insulin consists of two disulfide-linked polypeptide chains.
A basic polypeptide isolated from streptomyces netropsis.
Jacobs, Jaco (2015) Towards polypeptide based nanoparticles.
TGTTGTGATCCATATTTCGCCTTCACCACCGAAATTTTAGTGAACCGAAGATTTCAGGTCACTGTCCATTC mRNA 5 cap CACUUGGCUUCUAAAGUCCAGUGACAG Polypeptide GTTCTCGTTACTTCCGTCTCGATTACTAAGATTTGATTACTTTTAGAAAAATGACCGAAGATCCAAAGCAGATTGCCCAGGAGACTGAG.
A polypeptide hormone that regulates glucose metabolism.
For example, hemoglobin contains four polypeptide chains.
Show more

How to use "폴리펩타이드, 폴리펩티드" in a Korean sentence

"에피토프"란 용어는 면역글로불린 또는 T-세포 수용체에 특이적으로 결합하는 임의의 폴리펩타이드 결정인자를 포함한다.
일부 실시형태에서, 화합물은 제1 폴리펩타이드 및 제2 폴리펩타이드를 포함한다.
함- 구조 : 2쌍의 폴리펩티드 사슬로 구성된 단백질 분자- 종류와.
용어 "에피토프"는 항체에 특이적으로 결합할 수 있는 임의의 폴리펩티드 결정자를 포함한다.
상부 패널은 각각의 폴리펩타이드 쇄를 별개로 나타낸다.
"코딩 서열"은 유전자의 폴리펩티드 산물에 대한 코드에 기여하는 임의의 폴리뉴클레오티드 서열을 의미한다.
일부 소수의 T 세포들은 γ와 δ 폴리펩티드 쇄로 구성된 세포수용체를 가진다.
아미노산은 펩티드 결합에 의해 사슬에서 폴리펩티드 사슬을 형성하기 위하여 함께 결합됩니다.
상기 용어는 전장 폴리펩타이드 및 합성 펩타이드로부터 소화된 두 펩타이드에 적용된다.
표적 항원에의 결합은 그 폴리펩티드 또는 펩티드가 기능적인 지의 여부에 의존한다.

Top dictionary queries

English - Korean